Sodium Sulphate×

Active tenders in Sodium Sulphate

Bharat Heavy Electricals Limited - bhel Tenders

nutrient broth

Huzur, Madhya Pradesh

Refno: 21466118

Last Date: 22 Nov 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Oil And Natural Gas Corporation Limited - ongc Tenders

sodium sulphite- ongc

Mahesana, Gujarat

Refno: 21103806

Last Date: 04 Nov 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Tamil Nadu Newsprint And Papers Limited - tnpl Tenders

procurement of sodium sulphate (in jumbo bags) for pulp mill of tnpl unit ii.

Chennai, Tamil Nadu

Refno: 20918458

Last Date: 12 Oct 2021

Amount(Approx): 1.50 Cr.

Read More

Archived

ministry of agriculture and farmers welfare - agricoop Tenders

supply of 1 methanol extrapure pure 99.8 5 litre niasmaao1 413115 20 2 phenol crystalline pure (c6h5oh), m= 94.11g/mol, assay 99, melting range 39-41c 500 gram niasmaao1 413115 20 3 sodium potassium tartrate tetrahydrate extrapure ar, 99 1000 gram niasmaao1 413115 20 4 sodium sulphate anhydrous extrapure ar, 99.5 1000 gram niasmaao1 413115 20 5 cuprous oxide pure 500 gram niasmaao1 413115 20 7 acetone pure 2 litre niasmaao1 413115 20 8 ammonium molybdate tetrahydrate 98 500 gram niasmaao1 413115 20 9 folin and ciocalteus phenol (fcp) reagent ar grade 500 ml niasmaao1 413115 20 10 sodium carbonate anhydrous extrapure ar, 99.9 1000 gram niasmaao1 413115 20 11 sodium bicarbonate extrapure, 99 1000 gram niasmaao1 413115 20 12 gallic acid pure - 98 100 gram niasmaao1 413115 20 13 alluminium chloride hexahydrate ar 99 500 gram niasmaao1 413115 20 14 sodium hydroxide pellets extrapure ar, 98 1000 gram niasmaao1 413115 20 15 sodium nitrate extrapure ar, acs, 99 1000 gram niasmaao1 413115 20 16 sodium acetate trihydrate extrapure ar, 99.5 1000 gram niasmaao1 413115 20 17 glacial acetic acid (ch3cooh) ar 99.9 pure 1 litre niasmaao1 413115 20 18 tptz tripyridyl 1-5-triazine pure 5 gram niasmaao1 413115 20 19 orthophosphoric acid extrapure ar, acs, 85 1 litre niasmaao1 413115 20 20 diphenyl pycril hydrazyl (dpph) c18h12n5o6 m.w=394.32 250 mg niasmaao1 413115 20 21 sulphosalycylic acid aqueous 500 gram niasmaao1 413115 20 22 toluene extrapure ar, 99.5 1 litre niasmaao1 413115 20 23 l-proline extrapure chr, 99 300 gram niasmaao1 413115 20 24 dimethyl sulphoxide (dmso) extrapure, 99 5 litre niasmaao1 413115 20 25 l- ascorbic acid extrapure 300 gram niasmaao1 413115 20 26 2,6-dichlorophenol indophenol sodium salt pure 98 10 gram niasmaao1 413115 20 27 oxalic acid ar 99.5 1000 gram niasmaao1 413115 20 28 phenolphthalein indicator 1 soln in ethanol 500 gram niasmaao1 413115 20 29 sodium acetate trihydrate extrapure ar, acs, xiplus, 99.5 1000 gram niasmaao1 413115 20 30 ascorbic acid ar grade 200 gram niasmaao1 413115 20 31 d-glucose anydrous 500 gram niasmaao1 413115 20 32 copper sulphate (cuso4.5h2o) pure 99.0 500 gram niasmaao1 413115 20 33 sodium nitrite pure 500 gram niasmaao1 413115 20 34 hydrochloric acid (hcl) concentrated, m.w=36.46 2.5 litre niasmaao1 413115 20 35 fecl3.6h2o (iron chloride hexahydrated) hexahydrated 250 gram niasmaao1 413115 20 36 sulphuric acid (h2so4) ar m.w=98.08 2.5 litre niasmaao1 413115 20

Pune, Maharashtra

Refno: 20468363

Last Date: 03 Sep 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Municipal Corporation Tenders

supply of chemicals--1 benzene ar 2 pet ether or pet benzene 40-60c 3 fehling a solution ar 4 fehling b solution ar 5 silver nitrate solution 0.1n 6 kit for adulteration testing kit for milk ( 11 parameter)( (k088a) 7 kit for adulteration testing kit for milk ( 06 parameter)( (k088b) 8 ammonia solution 25 ar 9 toluene ar 10 xylene ar 11 hydrochloric acid colourless 35-38 assay ar 12 sulphuric acid assay -96-98 ar 13 sodium hydroxide pellets ar 14 iso butanol ar 15 amyl alcohol ar furfural free 16 sodium sulphate anhydrous ar anhydrous 17 ammonium chloride ar 18 standard buffer solution ph 4.0 19 standard buffer solution ph 7.0 20 standard buffer solution ph 10.0 21 glycerol anhydrous ar 22 chloroform ar 23 standard liquid solution of lovibond water testing (turbidimeter tb 300ir) 1) <0.1 ntu 2) 20 ntu 3) 200 ntu 24 hydrogen peroxide

Mumbai, Maharashtra

Refno: 20396579

Last Date: 11 Aug 2021

Amount(Approx): Ref. Doc.

Read More

Archived

MINISTRY OF PETROLEUM AND NATURAL GAS - mpng Tenders

supply of sodium sulphite- ongc.

Raigad, Maharashtra

Refno: 20290961

Last Date: 13 Aug 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Ministry Of Human Resources Department - mhrd Tenders

supply of 1 acetone 2.5 ltr chemicals 2 nos. purchase.shivaji 110027 15 2 sodium hydroxide pellets 500gm chemicals 1 nos. purchase.shivaji 110027 15 3 phosphomolybdic acid 25gm chemicals 1 nos. purchase.shivaji 110027 15 4 boric acid 500gm chemicals 1 nos. purchase.shivaji 110027 15 5 sodium tetraborate 500gm chemicals 1 nos. purchase.shivaji 110027 15 6 dichloromethane 500ml chemicals 1 nos. purchase.shivaji 110027 15 7 ferric chloride 500gm chemicals 1 nos. purchase.shivaji 110027 15 8 molischs reagent 100ml chemicals 1 nos. purchase.shivaji 110027 15 9 ammonia 500ml chemicals 2 nos. purchase.shivaji 110027 15 10 hexanes 1 ltr chemicals 1 nos. purchase.shivaji 110027 15 11 sodium sulphate 500gm chemicals 2 nos. purchase.shivaji 110027 15 12 sodium hydroxide pellets 500gm chemicals 2 nos. purchase.shivaji 110027 15 13 sodium potassium tartarate 500gm chemicals 1 nos. purchase.shivaji 110027 15 14 sucrose 500gm chemicals 2 nos. purchase.shivaji 110027 15 15 sodium chloride 500gm chemicals 5 nos. purchase.shivaji 110027 15 16 fehling a, 500ml chemicals 3 nos. purchase.shivaji 110027 15 17 fehling b, 500ml chemicals 3 nos. purchase.shivaji 110027 15 18 fructose 500gm chemicals 2 nos. purchase.shivaji 110027 15 19 benedicts reagent 500ml chemicals 2 nos. purchase.shivaji 110027 15 20 cyclohexane 500ml chemicals 2 nos. purchase.shivaji 110027 15 21 chloroform 500ml chemicals 2 nos. purchase.shivaji 110027 15 22 petroleum ether 500ml chemicals 3 nos. purchase.shivaji 110027 15 23 sulphuric acid 2.5 ltr chemicals 2 nos. purchase.shivaji 110027 15 24 tris hcl buffer 500gm chemicals 1 nos. purchase.shivaji 110027 15 25 sodium acetate 500gm chemicals 2 nos. purchase.shivaji 110027 15 26 isopropanol 2.5 ltr chemicals 2 nos. purchase.shivaji 110027 1527 dextrose 500gm chemicals 3 nos. purchase.shivaji 110027 15 28 maltose 250gm chemicals 2 nos. purchase.shivaji 110027 15 29 tlc plates chemicals 3 pack purchase.shivaji 110027 15 30 sds 500gm chemicals 2 nos. purchase.shivaji 110027 15 31 isoamyl alcohol 500ml chemicals 2 nos. purchase.shivaji 110027 15 32 diphenylamine 250gm chemicals 2 nos. purchase.shivaji 110027 15 33 hcl 2.5 ltr chemicals 2 nos. purchase.shivaji 110027 15 34 n-butanol 500ml chemicals 2 nos. purchase.shivaji 110027 15 35 magnesium chloride chemicals 2 nos. purchase.shivaji 110027 15 36 calcium chloride 500gm chemicals 2 nos. purchase.shivaji 110027 15 37 sodium hydroxide pellets 500gm chemicals 1 nos. purchase.shivaji 110027 15 38 ethanol lab reagent 500 ml chemicals 2 nos. purchase.shivaji 110027 15 39 primer for pcr 8f:5 agagtttgatcctggctcag31492r:5- ggttaccttgttacgactt-3 chemicals 1 nos. purchase.shivaji 110027 15 40 d.i. water 5 ltr chemicals 2 nos. purchase.shivaji 110027 15 41 acetone 500ml (molecular grade) chemicals 4 nos. purchase.shivaji 110027 15 42 acetone 500ml chemicals 2 nos. purchase.shivaji 110027 15 43 immersion oil for microscopy 125ml chemicals 1 nos. purchase.shivaji 110027 15 44 water for chromatography 1 ltr chemicals 1 nos. purchase.shivaji 110027 15 45 potassium dihydrogen phosphate 500gm chemicals 1 nos. purchase.shivaji 110027 15 46 polysorbate 80, 500ml chemicals 1 nos. purchase.shivaji 110027 15 47 genei dna fingerprinting teaching kit, 5 expts (rflp) chemicals 1 nos. purchase.shivaji 110027 15 48 muller hilton1 agar 500gm chemicals 1 nos. purchase.shivaji 110027 15 49 genei dna fingerprinting teaching kit, 5 expts (rapd) chemicals 1 nos. purchase.shivaji 110027 15 50 oxoid iso- sensitest agar (hisensitivity test broth 500 gm) for antimicrobial susceptibility tests chemicals 1 nos. purchase.shivaji 110027 15 51 tungsten (vi) chloride 10gm chemicals 1 nos. purchase.shivaji 110027 15 52 soya peptone 500gm chemicals 1 nos. purchase.shivaji 110027 15 53 colchicine 1 gm chemicals 2 nos. purchase.shivaji 110027 15 54 lecithin ex. soya, 30 500gm chemicals 1 nos. purchase.shivaji 110027 15 55 agar powder, bacter. grade 500gm chemicals 2 nos. purchase.shivaji 110027 15 56 zinc chloride 500gm chemicals 1 nos. purchase.shivaji 110027 15 57 lb nutrient agar 500gm chemicals 2 nos. purchase.shivaji 110027 15 58 lb nutrient broth 500gm chemicals 3 nos. purchase.shivaji 110027 15 59 silver solder paste 10 grams chemicals 1 nos. purchase.shivaji 110027 15 60 casein peptone chemicals 1 nos. purchase.shivaji 110027 15 61 -amylase from bacillus licheniformis (cas no. 9000-85-5) 100mg chemicals 2 nos. purchase.shivaji 110027 15 62 zinc stearate (technical grade) 1kg chemicals 1 nos. purchase.shivaji 110027 15 63 lanolin chemicals 2 nos. purchase.shivaji 110027 15 64 brij 35 detergent, 30 aqueous solution cas 9002-92-0 100ml chemicals 2 nos. purchase.shivaji 110027 15 65 strontium hydroxide 25gm chemicals 4 nos. purchase.shivaji 110027 15 66 calcium thioglycolate trihydrate 25 gm (cas rn: 5793-98-6) chemicals 4 nos. purchase.shivaji 110027 15 67 p-anisidine 250gm cas no.: 104-94-9 chemicals 2 nos. purchase.shivaji 110027 15 68 o-anisidine 100gm cas no.: 90-04-0 chemicals 2 nos. purchase.shivaji 110027 15 69 chloroauric acid chemicals 1 nos. purchase.shivaji 110027 15 70 deoxyribonucleic acid 5mg cas no.: 91080-16-9 chemicals 1 nos. purchase.shivaji 110027 15 71 bovine serum albumin 100gm chemicals 1 nos. purchase.shivaji 110027 15 72 isopropyl palmitate 1 kg chemicals 1 nos. purchase.shivaji 110027 15 73 glycerol monostearate chemicals 1 nos. purchase.shivaji 110027 15 74 calcium sulfate 500gm chemicals 1 nos. purchase.shivaji 110027 15 75 saccharin sodium salt hydrate 500gm chemicals 1 nos. purchase.shivaji 110027 15 76 pectin (l-arabinose) chemicals 1 nos. purchase.shivaji 110027 15 77 p-bromobenzaldehyde chemicals 1 nos. purchase.shivaji 110027 15 78 p-toluidine chemicals 1 nos. purchase.shivaji 110027 15 79 o-vanillin chemicals 1 nos. purchase.shivaji 110027 15 80 p-vanillin chemicals 1 nos. purchase.shivaji 110027 15 81 thiamine hydrochloride chemicals 1 nos. purchase.shivaji 110027 15 82 calcon 50 gm cas number 2538-85-4 chemicals 1 nos. purchase.shivaji 110027 15 83 murexide 25gm chemicals 1 nos. purchase.shivaji 110027 15 84 calmagite 10gm cas number 3147-14-6 chemicals 1 nos. purchase.shivaji 110027 15 85 calmagite 25gm cas number 3147-14-6 chemicals 1 nos. purchase.shivaji 110027 15 86 variamine blue b 1gm cas rn: 3566-44-7 chemicals 1 nos. purchase.shivaji 110027 15 87 variamine blue b 25 gm cas rn: 3566-44-7 chemicals 1 nos. purchase.shivaji 110027 15 88 phthalonitrile chemicals 1 nos. purchase.shivaji 110027 15 89 dbu base (1,8- diazabicyclo(5.4.0)undec-7- ene) chemicals 1 nos. purchase.shivaji 110027 15

Delhi, Delhi

Refno: 20131342

Last Date: 10 Jul 2021

Amount(Approx): Ref. Doc.

Read More

Archived

INDIAN ARMY Tenders

polyethylene glycol (purgative powder) ip 118gm, sodium chloride 2.93 gm, potassium chloride 1.484 gm, sodium bicarbonate 3.37 gm, sodium sulphate 11.35gm

Delhi, Delhi

Refno: 20080390

Last Date: 30 Jul 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Tamil Nadu Newsprint And Papers Limited - tnpl Tenders

procurement of sodium sulphate.

Chennai, Tamil Nadu

Refno: 19971208

Last Date: 24 Jun 2021

Amount(Approx): 3.76 Cr.

Read More

Archived

Ministry Of Petroleum And Natural Gas - mpng Tenders

supply of sodium sulphite- ongc.

Gandhinagar, Gujarat

Refno: 19951091

Last Date: 29 Jun 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Balmer Lawrie And Company Limited - blcl Tenders

tender for supply of sodium sulphite for industrial use.

Multi city, Multi State

Refno: 19929689

Last Date: 18 Jun 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Uranium Corporation of India Limited - ucil Tenders

sale of sodium sulphate

Cuddapah, Andhra Pradesh

Refno: 19744008

Last Date: 31 May 2021

Amount(Approx): 4.50 Cr.

Read More

Archived

Uranium Corporation of India Limited - ucil Tenders

supply of anhydrous sodium sulphate packed in 50kg hdpe bag. .

Ranchi*, Jharkhand

Refno: 19726981

Last Date: 31 May 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Mecon Limited Tenders

tender for contract manpower requirement for spillage cleaning in sodium sulphate recovery plant, causticization, slaker and powder unloading plant attummalapalle of m/s ucil, andhra pradesh.

Singhbhum, Jharkhand

Refno: 19548407

Last Date: 19 Apr 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Government Of West Bengal - gwb Tenders

supply of 1. ethanol(100). 2. triethanolamine. 3. diethanolamine. 4 edta 5 nadph disodium. 6. manganese chloride. 7. cu-zn sod (30000 u/mg lyophilisate). 8. n-butanol. 9. glacial acetic acid. 10. phenol(laboratory grade). 11. ninhydrin 12. acetone. 13. agarose. 14. bisacrylamide. 15. hci. 16. tris. 17. temed. 18. ammonium persulfate. 19, acrylamide 20. ponceau red. 21. amido black 22. coumassie blue. 23, sodium barbiturate 24. barbituric acid. 25. cone. sulfuric acid 26. cupric acetate (neutral). 27. resorcinol. 28. crystal iodine. 29. sulphur powder. 30. ammonium sulphate 31. sodium nitroprusside, 32. liquor ammonia. 33. benzidine solution. 34. hydrogen peroxide. 35. phosphomolybdic acid. 36. phenylhydrazine. 37. concentrated nitric acid.38 silver nitrate 39. potassium oxalate(2) 40. ammonium molybdate 41. 2 sodium carbonate. 42. 10 barium chloride. 43. sodium hypobromite solution. 44 urease powder. 45. phenolpthalein. 46 phosphotungstic acid. 47. picric acid solution. 48 sodium hydroxide. 49. ammonium hydroxide. 50 liquid bromine. 51 orthophosphoric acid. 52. ferric chloride. 53 magnesium sulphate. 54. sodium cyanide. 55 indophenol dye. 56 glouse-6-phosphate powder. 57 phenazinemethosulphate 58. sodium nitrate. 59 methylene blue. 60 methylamine hydrochloride. 61. alcian blue. 62. di-sodium hydrogen phosphate 63. sodium di-hydrogen phosphate. 64. sodium acetate. 65. hydroxymethylaminomethane, 66 fuchsin basic 67. paraffin wax.(58 60c) 68 paraffin wax.(60n-62nc) 69 hematoxylin powder. 70 tri-sodium citrate 71. acetone. 72 liquid soap, 73 isopropyl alcohol. 74. xylene 75 methanol. 76. sodium citrate. 77 eosin powder 78. formalin. 79 glycerin 80. leishman stain. 81 absolute alcohol 82. pap stain 83 bilirubin84. mercuric oxide 85, ammonium potassium alum. 86, drabskin reagent, 87. dpx reagent. 88. giemsa stain. 89. glucose powder. 90. immersion oil 91. cholesterol. 92. uric acid. 93. sugar. 94. paraffin wax.(54-56c) 95. sodium hydrogen sulphate 96. distilled water. 97. sodium chloride. 98. acetone free methanol, 99. 1 gentain violet. 100. sodium sulphate. 101 double oxalate power. 102. yeast extract. 103. h202. 104. lysol. 105, n.n.n.n.tetramethylparaphenelenedi aminedihydrochloride. 106. liquid paraffin. 107. neutral red, 108. oxalic acid. 109 potassium iodide 110, potassium dichromate. 111. 4-aminobenzoic acid, 112. p-diethylaminobenzaldehyde. 113. plasticin. 114. rectified spirit. 115. potassium hydroxide 116. salfanilic acid 117. seffranine. 118. tryptone. 119. arginine 120. lysine. 121. crystal violet. 122. sodium hypochlorite(4). 123. manganese sulphate. 124. l-arginine hydrochloride. 125. phenol crystal, 126. lysol. 127. antibiotic sensitivity disc. 128. a-naphthylanine reagent.

Burdwan, West Bengal

Refno: 19547308

Last Date: 12 May 2021

Amount(Approx): Ref. Doc.

Read More

Archived

DEPARTMENT OF SPACE Tenders

supply of sodium sulphate as per is: 247.

Kanchipuram, Tamil Nadu

Refno: 19472843

Last Date: 12 Apr 2021

Amount(Approx): Ref. Doc.

Read More

Archived

MINISTRY OF DEFENCE - mod Tenders

supply of sodium sulphate anhydrous grade a, as per.

Multi city, Multi State

Refno: 19472823

Last Date: 10 Apr 2021

Amount(Approx): Ref. Doc.

Read More

Archived

Mecon Limited Tenders

tender for contract manpower requirement for spillage cleaning in sodium sulphate recovery plant, causticization, slaker and powder unloading plant at tummalapalle of m/s ucil, andhra pradesh.

Cuddapah, Andhra Pradesh

Refno: 19412294

Last Date: 12 Apr 2021

Amount(Approx): Ref. Doc.

Read More

Archived

MINISTRY OF STEEL Tenders

supply of sodium sulphite as per is: 247.

Sundergarh, Orissa

Refno: 19029004

Last Date: 11 Feb 2021

Amount(Approx): Ref. Doc.

Read More

Archived

GOVERNMENT COLLEGE Tenders

supply of chemicals-1 2,4-dinitrophenyl hydrazine 500 g 2 acetanilide 500 g 3 acetone 500 ml 4 alpha naphthol 500 g 5 aluminium borate 500 g 6 aluminium chloride 500 gm f aluminium nitrate 500 g 8 aluminium phosphate 500 g 9 aluminium sulphate (ar) 500 g 10 ammonium borate 500 g 11 ammonium carbonate 500 g 12 ammonium chloride 500 gm 13 ammonium fluoride 500 g 14 ammonium molybdate 100 g 15 ammonium nitrate 500 g 16 ammonium oxalate (ar) 500 g 17 ammonium phosphate 500 g 18 ammonium sulphate (ar) 500 g 19 ammonium thiocyanate 500 g 20 aniline 500 ml 21 anthracene 500 g 22 barium carbonate (ar) 500 g 23 barium chloride (ar) 500 g 24 barium fluoride 500 g 25 barium hydroxide 500 g 26 barium nitrate 500 g 27 barium oxalate 500 g 28 barium phosphate 500 g 29 barium sulphate 500 g 30 benzaldehyde 500 ml 31 benzamide 500 g 32 benzene 500 ml 33 benzoic acid 500 g 34 benzophenone 500 g 35 benzoyl chloride 500 ml 36 beta napthol 500 g 37 biphenyl (ar) 100 g 38 bismuth nitrate 100 g 39 borax 500 g 40 borshes reagent 125 ml 41 bromine water 500 ml 42 calcium acetate 500 g 43 calcium carbonate (ar) 500 g 44 calcium chloride (fused) 500 g 45 calcium fluoride 500 g 46 calcium hydroxide 500 g 47 calcium oxalate 500 g 48 calcium phosphate 500 g 49 calcium sulphate 500 g 50 carbon tetrachloride 500 ml 51 chlorobenzeen 500 ml 52 chloroform 500 ml 53 chromium sulphate 500 g 54 cinnamaldehyde 500 ml 55 cinnamic acid 500 g 56 cobalt acetate 100 g 57 cobalt nitrate 100 g 58 copper nitrate 500 g 59 copper sulphate (ar) 500 g 60 crystalline barium chloride (ar) 500 g 61 dimethyl glyoxime 100 g 62 diphenyl amine 100 g 63 diphenyl carbazide 100 g 64 ethyl acetate 500 ml 65 ethyl benzoate 500 ml 66 fehlings solution no.l 500 ml 67 fehlings solution no.2 500 ml 68 ferric chloride 500 g 69 ferrous sulphide sticks 500 g 70 glucose (d) (ar) 500 g 71 glycerin 500 ml 72 lead acetate 500 g 73 lead borate 500 g 74 lead carbonate 500 g 75 lead monoxide 100 g 76 lead nitrate 500 g 77 lead oxide 500 g 78 lead phosphate 500 a 79 magnesium carbonate 500 g 80 magnesium chloride 500 g 81 magnesium phosphate 500 g 82 magnesium sulphate 500 g 83 magnesium sulphate (ar) 500 g 84 magneson reagent 125 ml 85 manganese carbonate 500 g 86 manganese dioxide 500 g 87 manganese sulphate 500 g 88 methyl benzoate 500 ml 89 methyl salicilate 500 ml 90 molischs reagent 125 ml 91 naphthalein 500 g 92 nesslers reagent 125 ml 93 nickel sulphate (ar) 500 g 94 nitro benzeen 500 ml 95 o-cresol 500 ml 96 oxime reagent 500 g 97 para rosaniline 100 g 98 p - dichloro benzene 500 g 99 phenol 500 ml 100 phenyl hydroxime 500 g 101 phenyl hydrazine . hydrochloride 250 g 102 picric acid 500 g 103 potassium ferrocyanide 500 g 104 potassium sulphate (ar) 500 g 105 potassium nitrate 500 g 106 pthalic acid 500 g 107 pthalic anhydride 500 g 108 resorcinol 100 g 109 salicylic acid 500 g 110 salicylicaldehyde 500 g 111 semi carbazide 500 g 112 shifts reagent 125 ml 113 soda lime 500 g 114 sodium acetate 500 g 115 sodium bisulphate 500 g 116 sodium meta bisulphate 500 g 117 sodium metal 500 g 118 sodium nitrate 500 g 119 sodium nitrite 500 g 120 sodium nitroprusside 100 g 121 sodium potassium tartarate 500 g 122 sodium sulfite 500 g 123 sodium sulphate 500 g 124 sodium thiosulphate (ar) 500 g 125 strontium nitrate 500 g 126 tartaric acid 500 g 127 tollens reagent 100 ml 128 toluene 500 ml 129 zinc borate 500 g 130 zinc carbonate 500 g 131 zinc dust 500 g 132 zinc nitrate 500 g 133 zinc phosphate 500 g 134 zirconyl nitrate 100 g

Thiruvananthapuram, Kerala

Refno: 18945789

Last Date: 29 Jan 2021

Amount(Approx): 1.78 Lac

Read More

Archived

INDIAN TENDER INFORMATION

Get All The Latest All Tender/Project/Result Information From Across India. Search Road Tenders Tenders From Live And Archive Business Category. All Tenders Are Updated On Daily Basis On Our Website. Get All The Latest All Tender/Project/Result Information From Across India. Search Road Tenders Tenders From Live And Archive Business Category. All Tenders Are Updated On Daily Basis On Our Website. Get All The Latest All Tender/Project/Result Information From Across India. Search Road Tenders Tenders From Live And Archive Business Category. All Tenders Are Updated On Daily Basis On Our Website. Get All The Latest All Tender/Project/Result Information From Across India. Search Road Tenders Tenders From Live And Archive Business Category. All Tenders Are Updated On Daily Basis On Our Website.

TENDER BY LOCATIONS